Review



rabbit anti p jak2 antibody  (Cell Signaling Technology Inc)


Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Cell Signaling Technology Inc rabbit anti p jak2 antibody
    Rabbit Anti P Jak2 Antibody, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1456 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+anti+p+jak2+antibody/Phospho-Jak2+(Tyr1007%2F1008)+Antibody/10__1134_slash_s160767292560160x-56-13-18
    Average 96 stars, based on 1456 article reviews
    rabbit anti p jak2 antibody - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    Western Blot:

    Article Title: BAG3 promotes proliferation and migration of arterial smooth muscle cells by regulating STAT3 phosphorylation in diabetic vascular remodeling
    Article Snippet: .. Rabbit-anti-BAG3 antibody (10599-1-AP, Proteintech, WB: 1:2000; IP: 1:1000; IF: 1:100), rabbit-anti-MMP2 antibody (10373-2-AP, Proteintech, WB: 1:1000), rabbit-anti-MMP9 antibody (10375-2-AP, Proteintech, WB: 1:1000), rabbit-anti-PCNA antibody (10205-2-AP, Proteintech, WB: 1:1000), mouse-anti-Tubulin antibody (66031-1-Ig, Proteintech, WB: 1:1000), mouse-anti-GAPDH antibody (60004-1-Ig, Proteintech, WB: 1:1000), mouse-anti-Flag antibody (66008-4-Ig, Proteintech, WB: 1:1000; IP: 1:1000), rabbit-anti-JAK2 antibody (3230 S, CST, WB: 1:1000), rabbit-anti-p-JAK2 antibody (3776 S, CST, WB: 1:1000), mouse-anti-STAT3 antibody (9139 S, CST, WB: 1:1000; IP: 1:1000), rabbit-anti-p-STAT3(705) antibody (9145 S, CST, WB: 1:1000; IF: 1:100), rabbit-anti-p-STAT3(727) antibody (94,994 S, CST, WB: 1:1000; IF: 1:100), mouse-anti-ERK1/2 antibody (sc-514,302, Santa, WB: 1:1000), mouse-anti-p-ERK1/2 antibody (sc-81,492, Santa, WB: 1:1000), mouse-anti-GATA3 antibody (66400-1-Ig, Proteintech, WB: 1:1000), HRP goat-anti-rabbit IgG antibody (A21020, Abbkine, WB: 1:10000), HRP goat-anti-mouse IgG antibody (A21010, Abbkine, WB: 1:10000), Rhodamine(TRITIC) conjugated goat-anti-rabbit IgG(H + L) (SA00007-2, Proteintech, IF: 1:200), Protein A/G magnetic Beads (Cat#B23202, Biotool), AntiFade Mounting Medium (Beyotime), CCK-8 cell viability kit (B34304, Bimake), Higene transfection reagent (C1506, APPLYGEN), Jet kit (101,000,046, Polyplus), protease inhibitor (B14001, Bimake), phosphatase inhibitors (B15001, Bimake), SH-4-54 (S7337, Selleck), U0126-EtOH (S1102, Selleck). ..

    Article Title: BAG3 promotes proliferation and migration of arterial smooth muscle cells by regulating STAT3 phosphorylation in diabetic vascular remodeling
    Article Snippet: .. 2.17 Antibodies and reagents Page 7/24 Rabbit-anti-BAG3 antibody (10599-1-AP, Proteintech, WB: 1:2000; IP: 1:1000; IF: 1:100), rabbit-anti-MMP2 antibody (10373-2-AP, Proteintech, WB: 1:1000), rabbit-anti-MMP9 antibody (10375-2-AP, Proteintech, WB: 1:1000), rabbit-anti-PCNA antibody (10205-2-AP, Proteintech, WB: 1:1000), mouse-anti-Tubulin antibody (66031-1-Ig, Proteintech, WB: 1:1000), mouse-anti-GAPDH antibody (60004-1-Ig, Proteintech, WB: 1:1000), mouse-anti-Flag antibody (66008-4-Ig, Proteintech, WB: 1:1000; IP: 1:1000), rabbit-anti-JAK2 antibody (3230S, CST, WB: 1:1000), rabbit-anti-p-JAK2 antibody (3776S, CST, WB: 1:1000), mouse-anti-STAT3 antibody (9139S, CST, WB: 1:1000; IP: 1:1000), rabbit-anti-p-STAT3(705) antibody (9145S, CST, WB: 1:1000), rabbit-anti-p-STAT3(727) antibody (94994S, CST, WB: 1:1000), mouse-anti-ERK1/2 antibody (sc514302, Santa, WB: 1:1000), mouse-anti-p-ERK1/2 antibody (sc-81492, Santa, WB: 1:1000), mouse-antiGATA3 antibody (66400-1-Ig, Proteintech, WB: 1:1000), HRP goat-anti-rabbit IgG antibody (A21020, Abbkine, WB: 1:10000), HRP goat-anti-mouse IgG antibody (A21010, Abbkine, WB: 1:10000), Rhodamine(TRITIC) conjugated goat-anti-rabbit IgG(H + L) (SA00007-2, Proteintech, IF: 1:200), Protein A/G magnetic Beads (Cat#B23202, Biotool), AntiFade Mounting Medium (Beyotime), CCK-8 cell viability kit (B34304, Bimake), Higene transfection reagent (C1506, APPLYGEN), Jet kit (101000046, Polyplus), protease inhibitor (B14001, Bimake), phosphatase inhibitors (B15001, Bimake), SH-4-54 (S7337, Selleck), U0126-EtOH (S1102, Selleck). ..

    Article Title: BAG3 promotes proliferation and migration of arterial smooth muscle cells by regulating STAT3 phosphorylation in diabetic vascular remodeling.
    Article Snippet: .. Rabbit-anti-BAG3 antibody (10599-1-AP, Proteintech, WB: 1:2000; IP: 1:1000; IF: 1:100), rabbit-anti-MMP2 antibody (10373-2-AP, Proteintech, WB: 1:1000), rabbit-anti-MMP9 antibody (10375-2-AP, Proteintech, WB: 1:1000), rabbit-anti-PCNA antibody (10205-2-AP, Proteintech, WB: 1:1000), mouse-anti-Tubulin antibody (66031-1-Ig, Proteintech, WB: 1:1000), mouse-antiGAPDH antibody (60004-1-Ig, Proteintech, WB: 1:1000), mouse-anti-Flag antibody (66008-4-Ig, Proteintech, WB: 1:1000; IP: 1:1000), rabbit-anti-JAK2 antibody (3230 S, CST, WB: 1:1000), rabbit-anti-p-JAK2 antibody (3776 S, CST, WB: 1:1000), mouse-anti-STAT3 antibody (9139 S, CST, WB: 1:1000; IP: 1:1000), rabbit-anti-p-STAT3(705) antibody (9145 S, CST, WB: 1:1000; IF: 1:100), rabbit-anti-p-STAT3(727) antibody (94,994 S, CST, WB: 1:1000; IF: 1:100), mouse-anti-ERK1/2 antibody (sc514,302, Santa, WB: 1:1000), mouse-anti-p-ERK1/2 antibody (sc-81,492, Santa, WB: 1:1000), mouse-anti-GATA3 antibody (66400-1-Ig, Proteintech, WB: 1:1000), HRP goat-anti-rabbit IgG antibody (A21020, Abbkine, WB: 1:10000), HRP goat-anti-mouse IgG antibody (A21010, Abbkine, WB: 1:10000), Rhodamine(TRITIC) conjugated goat-anti-rabbit IgG(H + L) (SA00007-2, Proteintech, IF: 1:200), Protein A/G magnetic Beads (Cat#B23202, Biotool), AntiFade Mounting Medium (Beyotime), CCK-8 cell viability kit (B34304, Bimake), Higene transfection reagent (C1506, APPLYGEN), Jet kit (101,000,046, Polyplus), protease inhibitor (B14001, Bimake), phosphatase inhibitors (B15001, Bimake), SH-4-54 (S7337, Selleck), U0126-EtOH (S1102, Selleck). ..

    Magnetic Beads:

    Article Title: BAG3 promotes proliferation and migration of arterial smooth muscle cells by regulating STAT3 phosphorylation in diabetic vascular remodeling
    Article Snippet: .. Rabbit-anti-BAG3 antibody (10599-1-AP, Proteintech, WB: 1:2000; IP: 1:1000; IF: 1:100), rabbit-anti-MMP2 antibody (10373-2-AP, Proteintech, WB: 1:1000), rabbit-anti-MMP9 antibody (10375-2-AP, Proteintech, WB: 1:1000), rabbit-anti-PCNA antibody (10205-2-AP, Proteintech, WB: 1:1000), mouse-anti-Tubulin antibody (66031-1-Ig, Proteintech, WB: 1:1000), mouse-anti-GAPDH antibody (60004-1-Ig, Proteintech, WB: 1:1000), mouse-anti-Flag antibody (66008-4-Ig, Proteintech, WB: 1:1000; IP: 1:1000), rabbit-anti-JAK2 antibody (3230 S, CST, WB: 1:1000), rabbit-anti-p-JAK2 antibody (3776 S, CST, WB: 1:1000), mouse-anti-STAT3 antibody (9139 S, CST, WB: 1:1000; IP: 1:1000), rabbit-anti-p-STAT3(705) antibody (9145 S, CST, WB: 1:1000; IF: 1:100), rabbit-anti-p-STAT3(727) antibody (94,994 S, CST, WB: 1:1000; IF: 1:100), mouse-anti-ERK1/2 antibody (sc-514,302, Santa, WB: 1:1000), mouse-anti-p-ERK1/2 antibody (sc-81,492, Santa, WB: 1:1000), mouse-anti-GATA3 antibody (66400-1-Ig, Proteintech, WB: 1:1000), HRP goat-anti-rabbit IgG antibody (A21020, Abbkine, WB: 1:10000), HRP goat-anti-mouse IgG antibody (A21010, Abbkine, WB: 1:10000), Rhodamine(TRITIC) conjugated goat-anti-rabbit IgG(H + L) (SA00007-2, Proteintech, IF: 1:200), Protein A/G magnetic Beads (Cat#B23202, Biotool), AntiFade Mounting Medium (Beyotime), CCK-8 cell viability kit (B34304, Bimake), Higene transfection reagent (C1506, APPLYGEN), Jet kit (101,000,046, Polyplus), protease inhibitor (B14001, Bimake), phosphatase inhibitors (B15001, Bimake), SH-4-54 (S7337, Selleck), U0126-EtOH (S1102, Selleck). ..

    Article Title: BAG3 promotes proliferation and migration of arterial smooth muscle cells by regulating STAT3 phosphorylation in diabetic vascular remodeling
    Article Snippet: .. 2.17 Antibodies and reagents Page 7/24 Rabbit-anti-BAG3 antibody (10599-1-AP, Proteintech, WB: 1:2000; IP: 1:1000; IF: 1:100), rabbit-anti-MMP2 antibody (10373-2-AP, Proteintech, WB: 1:1000), rabbit-anti-MMP9 antibody (10375-2-AP, Proteintech, WB: 1:1000), rabbit-anti-PCNA antibody (10205-2-AP, Proteintech, WB: 1:1000), mouse-anti-Tubulin antibody (66031-1-Ig, Proteintech, WB: 1:1000), mouse-anti-GAPDH antibody (60004-1-Ig, Proteintech, WB: 1:1000), mouse-anti-Flag antibody (66008-4-Ig, Proteintech, WB: 1:1000; IP: 1:1000), rabbit-anti-JAK2 antibody (3230S, CST, WB: 1:1000), rabbit-anti-p-JAK2 antibody (3776S, CST, WB: 1:1000), mouse-anti-STAT3 antibody (9139S, CST, WB: 1:1000; IP: 1:1000), rabbit-anti-p-STAT3(705) antibody (9145S, CST, WB: 1:1000), rabbit-anti-p-STAT3(727) antibody (94994S, CST, WB: 1:1000), mouse-anti-ERK1/2 antibody (sc514302, Santa, WB: 1:1000), mouse-anti-p-ERK1/2 antibody (sc-81492, Santa, WB: 1:1000), mouse-antiGATA3 antibody (66400-1-Ig, Proteintech, WB: 1:1000), HRP goat-anti-rabbit IgG antibody (A21020, Abbkine, WB: 1:10000), HRP goat-anti-mouse IgG antibody (A21010, Abbkine, WB: 1:10000), Rhodamine(TRITIC) conjugated goat-anti-rabbit IgG(H + L) (SA00007-2, Proteintech, IF: 1:200), Protein A/G magnetic Beads (Cat#B23202, Biotool), AntiFade Mounting Medium (Beyotime), CCK-8 cell viability kit (B34304, Bimake), Higene transfection reagent (C1506, APPLYGEN), Jet kit (101000046, Polyplus), protease inhibitor (B14001, Bimake), phosphatase inhibitors (B15001, Bimake), SH-4-54 (S7337, Selleck), U0126-EtOH (S1102, Selleck). ..

    Article Title: BAG3 promotes proliferation and migration of arterial smooth muscle cells by regulating STAT3 phosphorylation in diabetic vascular remodeling.
    Article Snippet: .. Rabbit-anti-BAG3 antibody (10599-1-AP, Proteintech, WB: 1:2000; IP: 1:1000; IF: 1:100), rabbit-anti-MMP2 antibody (10373-2-AP, Proteintech, WB: 1:1000), rabbit-anti-MMP9 antibody (10375-2-AP, Proteintech, WB: 1:1000), rabbit-anti-PCNA antibody (10205-2-AP, Proteintech, WB: 1:1000), mouse-anti-Tubulin antibody (66031-1-Ig, Proteintech, WB: 1:1000), mouse-antiGAPDH antibody (60004-1-Ig, Proteintech, WB: 1:1000), mouse-anti-Flag antibody (66008-4-Ig, Proteintech, WB: 1:1000; IP: 1:1000), rabbit-anti-JAK2 antibody (3230 S, CST, WB: 1:1000), rabbit-anti-p-JAK2 antibody (3776 S, CST, WB: 1:1000), mouse-anti-STAT3 antibody (9139 S, CST, WB: 1:1000; IP: 1:1000), rabbit-anti-p-STAT3(705) antibody (9145 S, CST, WB: 1:1000; IF: 1:100), rabbit-anti-p-STAT3(727) antibody (94,994 S, CST, WB: 1:1000; IF: 1:100), mouse-anti-ERK1/2 antibody (sc514,302, Santa, WB: 1:1000), mouse-anti-p-ERK1/2 antibody (sc-81,492, Santa, WB: 1:1000), mouse-anti-GATA3 antibody (66400-1-Ig, Proteintech, WB: 1:1000), HRP goat-anti-rabbit IgG antibody (A21020, Abbkine, WB: 1:10000), HRP goat-anti-mouse IgG antibody (A21010, Abbkine, WB: 1:10000), Rhodamine(TRITIC) conjugated goat-anti-rabbit IgG(H + L) (SA00007-2, Proteintech, IF: 1:200), Protein A/G magnetic Beads (Cat#B23202, Biotool), AntiFade Mounting Medium (Beyotime), CCK-8 cell viability kit (B34304, Bimake), Higene transfection reagent (C1506, APPLYGEN), Jet kit (101,000,046, Polyplus), protease inhibitor (B14001, Bimake), phosphatase inhibitors (B15001, Bimake), SH-4-54 (S7337, Selleck), U0126-EtOH (S1102, Selleck). ..

    CCK-8 Assay:

    Article Title: BAG3 promotes proliferation and migration of arterial smooth muscle cells by regulating STAT3 phosphorylation in diabetic vascular remodeling
    Article Snippet: .. Rabbit-anti-BAG3 antibody (10599-1-AP, Proteintech, WB: 1:2000; IP: 1:1000; IF: 1:100), rabbit-anti-MMP2 antibody (10373-2-AP, Proteintech, WB: 1:1000), rabbit-anti-MMP9 antibody (10375-2-AP, Proteintech, WB: 1:1000), rabbit-anti-PCNA antibody (10205-2-AP, Proteintech, WB: 1:1000), mouse-anti-Tubulin antibody (66031-1-Ig, Proteintech, WB: 1:1000), mouse-anti-GAPDH antibody (60004-1-Ig, Proteintech, WB: 1:1000), mouse-anti-Flag antibody (66008-4-Ig, Proteintech, WB: 1:1000; IP: 1:1000), rabbit-anti-JAK2 antibody (3230 S, CST, WB: 1:1000), rabbit-anti-p-JAK2 antibody (3776 S, CST, WB: 1:1000), mouse-anti-STAT3 antibody (9139 S, CST, WB: 1:1000; IP: 1:1000), rabbit-anti-p-STAT3(705) antibody (9145 S, CST, WB: 1:1000; IF: 1:100), rabbit-anti-p-STAT3(727) antibody (94,994 S, CST, WB: 1:1000; IF: 1:100), mouse-anti-ERK1/2 antibody (sc-514,302, Santa, WB: 1:1000), mouse-anti-p-ERK1/2 antibody (sc-81,492, Santa, WB: 1:1000), mouse-anti-GATA3 antibody (66400-1-Ig, Proteintech, WB: 1:1000), HRP goat-anti-rabbit IgG antibody (A21020, Abbkine, WB: 1:10000), HRP goat-anti-mouse IgG antibody (A21010, Abbkine, WB: 1:10000), Rhodamine(TRITIC) conjugated goat-anti-rabbit IgG(H + L) (SA00007-2, Proteintech, IF: 1:200), Protein A/G magnetic Beads (Cat#B23202, Biotool), AntiFade Mounting Medium (Beyotime), CCK-8 cell viability kit (B34304, Bimake), Higene transfection reagent (C1506, APPLYGEN), Jet kit (101,000,046, Polyplus), protease inhibitor (B14001, Bimake), phosphatase inhibitors (B15001, Bimake), SH-4-54 (S7337, Selleck), U0126-EtOH (S1102, Selleck). ..

    Article Title: BAG3 promotes proliferation and migration of arterial smooth muscle cells by regulating STAT3 phosphorylation in diabetic vascular remodeling
    Article Snippet: .. 2.17 Antibodies and reagents Page 7/24 Rabbit-anti-BAG3 antibody (10599-1-AP, Proteintech, WB: 1:2000; IP: 1:1000; IF: 1:100), rabbit-anti-MMP2 antibody (10373-2-AP, Proteintech, WB: 1:1000), rabbit-anti-MMP9 antibody (10375-2-AP, Proteintech, WB: 1:1000), rabbit-anti-PCNA antibody (10205-2-AP, Proteintech, WB: 1:1000), mouse-anti-Tubulin antibody (66031-1-Ig, Proteintech, WB: 1:1000), mouse-anti-GAPDH antibody (60004-1-Ig, Proteintech, WB: 1:1000), mouse-anti-Flag antibody (66008-4-Ig, Proteintech, WB: 1:1000; IP: 1:1000), rabbit-anti-JAK2 antibody (3230S, CST, WB: 1:1000), rabbit-anti-p-JAK2 antibody (3776S, CST, WB: 1:1000), mouse-anti-STAT3 antibody (9139S, CST, WB: 1:1000; IP: 1:1000), rabbit-anti-p-STAT3(705) antibody (9145S, CST, WB: 1:1000), rabbit-anti-p-STAT3(727) antibody (94994S, CST, WB: 1:1000), mouse-anti-ERK1/2 antibody (sc514302, Santa, WB: 1:1000), mouse-anti-p-ERK1/2 antibody (sc-81492, Santa, WB: 1:1000), mouse-antiGATA3 antibody (66400-1-Ig, Proteintech, WB: 1:1000), HRP goat-anti-rabbit IgG antibody (A21020, Abbkine, WB: 1:10000), HRP goat-anti-mouse IgG antibody (A21010, Abbkine, WB: 1:10000), Rhodamine(TRITIC) conjugated goat-anti-rabbit IgG(H + L) (SA00007-2, Proteintech, IF: 1:200), Protein A/G magnetic Beads (Cat#B23202, Biotool), AntiFade Mounting Medium (Beyotime), CCK-8 cell viability kit (B34304, Bimake), Higene transfection reagent (C1506, APPLYGEN), Jet kit (101000046, Polyplus), protease inhibitor (B14001, Bimake), phosphatase inhibitors (B15001, Bimake), SH-4-54 (S7337, Selleck), U0126-EtOH (S1102, Selleck). ..

    Article Title: BAG3 promotes proliferation and migration of arterial smooth muscle cells by regulating STAT3 phosphorylation in diabetic vascular remodeling.
    Article Snippet: .. Rabbit-anti-BAG3 antibody (10599-1-AP, Proteintech, WB: 1:2000; IP: 1:1000; IF: 1:100), rabbit-anti-MMP2 antibody (10373-2-AP, Proteintech, WB: 1:1000), rabbit-anti-MMP9 antibody (10375-2-AP, Proteintech, WB: 1:1000), rabbit-anti-PCNA antibody (10205-2-AP, Proteintech, WB: 1:1000), mouse-anti-Tubulin antibody (66031-1-Ig, Proteintech, WB: 1:1000), mouse-antiGAPDH antibody (60004-1-Ig, Proteintech, WB: 1:1000), mouse-anti-Flag antibody (66008-4-Ig, Proteintech, WB: 1:1000; IP: 1:1000), rabbit-anti-JAK2 antibody (3230 S, CST, WB: 1:1000), rabbit-anti-p-JAK2 antibody (3776 S, CST, WB: 1:1000), mouse-anti-STAT3 antibody (9139 S, CST, WB: 1:1000; IP: 1:1000), rabbit-anti-p-STAT3(705) antibody (9145 S, CST, WB: 1:1000; IF: 1:100), rabbit-anti-p-STAT3(727) antibody (94,994 S, CST, WB: 1:1000; IF: 1:100), mouse-anti-ERK1/2 antibody (sc514,302, Santa, WB: 1:1000), mouse-anti-p-ERK1/2 antibody (sc-81,492, Santa, WB: 1:1000), mouse-anti-GATA3 antibody (66400-1-Ig, Proteintech, WB: 1:1000), HRP goat-anti-rabbit IgG antibody (A21020, Abbkine, WB: 1:10000), HRP goat-anti-mouse IgG antibody (A21010, Abbkine, WB: 1:10000), Rhodamine(TRITIC) conjugated goat-anti-rabbit IgG(H + L) (SA00007-2, Proteintech, IF: 1:200), Protein A/G magnetic Beads (Cat#B23202, Biotool), AntiFade Mounting Medium (Beyotime), CCK-8 cell viability kit (B34304, Bimake), Higene transfection reagent (C1506, APPLYGEN), Jet kit (101,000,046, Polyplus), protease inhibitor (B14001, Bimake), phosphatase inhibitors (B15001, Bimake), SH-4-54 (S7337, Selleck), U0126-EtOH (S1102, Selleck). ..

    Transfection:

    Article Title: BAG3 promotes proliferation and migration of arterial smooth muscle cells by regulating STAT3 phosphorylation in diabetic vascular remodeling
    Article Snippet: .. Rabbit-anti-BAG3 antibody (10599-1-AP, Proteintech, WB: 1:2000; IP: 1:1000; IF: 1:100), rabbit-anti-MMP2 antibody (10373-2-AP, Proteintech, WB: 1:1000), rabbit-anti-MMP9 antibody (10375-2-AP, Proteintech, WB: 1:1000), rabbit-anti-PCNA antibody (10205-2-AP, Proteintech, WB: 1:1000), mouse-anti-Tubulin antibody (66031-1-Ig, Proteintech, WB: 1:1000), mouse-anti-GAPDH antibody (60004-1-Ig, Proteintech, WB: 1:1000), mouse-anti-Flag antibody (66008-4-Ig, Proteintech, WB: 1:1000; IP: 1:1000), rabbit-anti-JAK2 antibody (3230 S, CST, WB: 1:1000), rabbit-anti-p-JAK2 antibody (3776 S, CST, WB: 1:1000), mouse-anti-STAT3 antibody (9139 S, CST, WB: 1:1000; IP: 1:1000), rabbit-anti-p-STAT3(705) antibody (9145 S, CST, WB: 1:1000; IF: 1:100), rabbit-anti-p-STAT3(727) antibody (94,994 S, CST, WB: 1:1000; IF: 1:100), mouse-anti-ERK1/2 antibody (sc-514,302, Santa, WB: 1:1000), mouse-anti-p-ERK1/2 antibody (sc-81,492, Santa, WB: 1:1000), mouse-anti-GATA3 antibody (66400-1-Ig, Proteintech, WB: 1:1000), HRP goat-anti-rabbit IgG antibody (A21020, Abbkine, WB: 1:10000), HRP goat-anti-mouse IgG antibody (A21010, Abbkine, WB: 1:10000), Rhodamine(TRITIC) conjugated goat-anti-rabbit IgG(H + L) (SA00007-2, Proteintech, IF: 1:200), Protein A/G magnetic Beads (Cat#B23202, Biotool), AntiFade Mounting Medium (Beyotime), CCK-8 cell viability kit (B34304, Bimake), Higene transfection reagent (C1506, APPLYGEN), Jet kit (101,000,046, Polyplus), protease inhibitor (B14001, Bimake), phosphatase inhibitors (B15001, Bimake), SH-4-54 (S7337, Selleck), U0126-EtOH (S1102, Selleck). ..

    Article Title: BAG3 promotes proliferation and migration of arterial smooth muscle cells by regulating STAT3 phosphorylation in diabetic vascular remodeling
    Article Snippet: .. 2.17 Antibodies and reagents Page 7/24 Rabbit-anti-BAG3 antibody (10599-1-AP, Proteintech, WB: 1:2000; IP: 1:1000; IF: 1:100), rabbit-anti-MMP2 antibody (10373-2-AP, Proteintech, WB: 1:1000), rabbit-anti-MMP9 antibody (10375-2-AP, Proteintech, WB: 1:1000), rabbit-anti-PCNA antibody (10205-2-AP, Proteintech, WB: 1:1000), mouse-anti-Tubulin antibody (66031-1-Ig, Proteintech, WB: 1:1000), mouse-anti-GAPDH antibody (60004-1-Ig, Proteintech, WB: 1:1000), mouse-anti-Flag antibody (66008-4-Ig, Proteintech, WB: 1:1000; IP: 1:1000), rabbit-anti-JAK2 antibody (3230S, CST, WB: 1:1000), rabbit-anti-p-JAK2 antibody (3776S, CST, WB: 1:1000), mouse-anti-STAT3 antibody (9139S, CST, WB: 1:1000; IP: 1:1000), rabbit-anti-p-STAT3(705) antibody (9145S, CST, WB: 1:1000), rabbit-anti-p-STAT3(727) antibody (94994S, CST, WB: 1:1000), mouse-anti-ERK1/2 antibody (sc514302, Santa, WB: 1:1000), mouse-anti-p-ERK1/2 antibody (sc-81492, Santa, WB: 1:1000), mouse-antiGATA3 antibody (66400-1-Ig, Proteintech, WB: 1:1000), HRP goat-anti-rabbit IgG antibody (A21020, Abbkine, WB: 1:10000), HRP goat-anti-mouse IgG antibody (A21010, Abbkine, WB: 1:10000), Rhodamine(TRITIC) conjugated goat-anti-rabbit IgG(H + L) (SA00007-2, Proteintech, IF: 1:200), Protein A/G magnetic Beads (Cat#B23202, Biotool), AntiFade Mounting Medium (Beyotime), CCK-8 cell viability kit (B34304, Bimake), Higene transfection reagent (C1506, APPLYGEN), Jet kit (101000046, Polyplus), protease inhibitor (B14001, Bimake), phosphatase inhibitors (B15001, Bimake), SH-4-54 (S7337, Selleck), U0126-EtOH (S1102, Selleck). ..

    Article Title: BAG3 promotes proliferation and migration of arterial smooth muscle cells by regulating STAT3 phosphorylation in diabetic vascular remodeling.
    Article Snippet: .. Rabbit-anti-BAG3 antibody (10599-1-AP, Proteintech, WB: 1:2000; IP: 1:1000; IF: 1:100), rabbit-anti-MMP2 antibody (10373-2-AP, Proteintech, WB: 1:1000), rabbit-anti-MMP9 antibody (10375-2-AP, Proteintech, WB: 1:1000), rabbit-anti-PCNA antibody (10205-2-AP, Proteintech, WB: 1:1000), mouse-anti-Tubulin antibody (66031-1-Ig, Proteintech, WB: 1:1000), mouse-antiGAPDH antibody (60004-1-Ig, Proteintech, WB: 1:1000), mouse-anti-Flag antibody (66008-4-Ig, Proteintech, WB: 1:1000; IP: 1:1000), rabbit-anti-JAK2 antibody (3230 S, CST, WB: 1:1000), rabbit-anti-p-JAK2 antibody (3776 S, CST, WB: 1:1000), mouse-anti-STAT3 antibody (9139 S, CST, WB: 1:1000; IP: 1:1000), rabbit-anti-p-STAT3(705) antibody (9145 S, CST, WB: 1:1000; IF: 1:100), rabbit-anti-p-STAT3(727) antibody (94,994 S, CST, WB: 1:1000; IF: 1:100), mouse-anti-ERK1/2 antibody (sc514,302, Santa, WB: 1:1000), mouse-anti-p-ERK1/2 antibody (sc-81,492, Santa, WB: 1:1000), mouse-anti-GATA3 antibody (66400-1-Ig, Proteintech, WB: 1:1000), HRP goat-anti-rabbit IgG antibody (A21020, Abbkine, WB: 1:10000), HRP goat-anti-mouse IgG antibody (A21010, Abbkine, WB: 1:10000), Rhodamine(TRITIC) conjugated goat-anti-rabbit IgG(H + L) (SA00007-2, Proteintech, IF: 1:200), Protein A/G magnetic Beads (Cat#B23202, Biotool), AntiFade Mounting Medium (Beyotime), CCK-8 cell viability kit (B34304, Bimake), Higene transfection reagent (C1506, APPLYGEN), Jet kit (101,000,046, Polyplus), protease inhibitor (B14001, Bimake), phosphatase inhibitors (B15001, Bimake), SH-4-54 (S7337, Selleck), U0126-EtOH (S1102, Selleck). ..

    Protease Inhibitor:

    Article Title: BAG3 promotes proliferation and migration of arterial smooth muscle cells by regulating STAT3 phosphorylation in diabetic vascular remodeling
    Article Snippet: .. Rabbit-anti-BAG3 antibody (10599-1-AP, Proteintech, WB: 1:2000; IP: 1:1000; IF: 1:100), rabbit-anti-MMP2 antibody (10373-2-AP, Proteintech, WB: 1:1000), rabbit-anti-MMP9 antibody (10375-2-AP, Proteintech, WB: 1:1000), rabbit-anti-PCNA antibody (10205-2-AP, Proteintech, WB: 1:1000), mouse-anti-Tubulin antibody (66031-1-Ig, Proteintech, WB: 1:1000), mouse-anti-GAPDH antibody (60004-1-Ig, Proteintech, WB: 1:1000), mouse-anti-Flag antibody (66008-4-Ig, Proteintech, WB: 1:1000; IP: 1:1000), rabbit-anti-JAK2 antibody (3230 S, CST, WB: 1:1000), rabbit-anti-p-JAK2 antibody (3776 S, CST, WB: 1:1000), mouse-anti-STAT3 antibody (9139 S, CST, WB: 1:1000; IP: 1:1000), rabbit-anti-p-STAT3(705) antibody (9145 S, CST, WB: 1:1000; IF: 1:100), rabbit-anti-p-STAT3(727) antibody (94,994 S, CST, WB: 1:1000; IF: 1:100), mouse-anti-ERK1/2 antibody (sc-514,302, Santa, WB: 1:1000), mouse-anti-p-ERK1/2 antibody (sc-81,492, Santa, WB: 1:1000), mouse-anti-GATA3 antibody (66400-1-Ig, Proteintech, WB: 1:1000), HRP goat-anti-rabbit IgG antibody (A21020, Abbkine, WB: 1:10000), HRP goat-anti-mouse IgG antibody (A21010, Abbkine, WB: 1:10000), Rhodamine(TRITIC) conjugated goat-anti-rabbit IgG(H + L) (SA00007-2, Proteintech, IF: 1:200), Protein A/G magnetic Beads (Cat#B23202, Biotool), AntiFade Mounting Medium (Beyotime), CCK-8 cell viability kit (B34304, Bimake), Higene transfection reagent (C1506, APPLYGEN), Jet kit (101,000,046, Polyplus), protease inhibitor (B14001, Bimake), phosphatase inhibitors (B15001, Bimake), SH-4-54 (S7337, Selleck), U0126-EtOH (S1102, Selleck). ..

    Article Title: BAG3 promotes proliferation and migration of arterial smooth muscle cells by regulating STAT3 phosphorylation in diabetic vascular remodeling
    Article Snippet: .. 2.17 Antibodies and reagents Page 7/24 Rabbit-anti-BAG3 antibody (10599-1-AP, Proteintech, WB: 1:2000; IP: 1:1000; IF: 1:100), rabbit-anti-MMP2 antibody (10373-2-AP, Proteintech, WB: 1:1000), rabbit-anti-MMP9 antibody (10375-2-AP, Proteintech, WB: 1:1000), rabbit-anti-PCNA antibody (10205-2-AP, Proteintech, WB: 1:1000), mouse-anti-Tubulin antibody (66031-1-Ig, Proteintech, WB: 1:1000), mouse-anti-GAPDH antibody (60004-1-Ig, Proteintech, WB: 1:1000), mouse-anti-Flag antibody (66008-4-Ig, Proteintech, WB: 1:1000; IP: 1:1000), rabbit-anti-JAK2 antibody (3230S, CST, WB: 1:1000), rabbit-anti-p-JAK2 antibody (3776S, CST, WB: 1:1000), mouse-anti-STAT3 antibody (9139S, CST, WB: 1:1000; IP: 1:1000), rabbit-anti-p-STAT3(705) antibody (9145S, CST, WB: 1:1000), rabbit-anti-p-STAT3(727) antibody (94994S, CST, WB: 1:1000), mouse-anti-ERK1/2 antibody (sc514302, Santa, WB: 1:1000), mouse-anti-p-ERK1/2 antibody (sc-81492, Santa, WB: 1:1000), mouse-antiGATA3 antibody (66400-1-Ig, Proteintech, WB: 1:1000), HRP goat-anti-rabbit IgG antibody (A21020, Abbkine, WB: 1:10000), HRP goat-anti-mouse IgG antibody (A21010, Abbkine, WB: 1:10000), Rhodamine(TRITIC) conjugated goat-anti-rabbit IgG(H + L) (SA00007-2, Proteintech, IF: 1:200), Protein A/G magnetic Beads (Cat#B23202, Biotool), AntiFade Mounting Medium (Beyotime), CCK-8 cell viability kit (B34304, Bimake), Higene transfection reagent (C1506, APPLYGEN), Jet kit (101000046, Polyplus), protease inhibitor (B14001, Bimake), phosphatase inhibitors (B15001, Bimake), SH-4-54 (S7337, Selleck), U0126-EtOH (S1102, Selleck). ..

    Article Title: BAG3 promotes proliferation and migration of arterial smooth muscle cells by regulating STAT3 phosphorylation in diabetic vascular remodeling.
    Article Snippet: .. Rabbit-anti-BAG3 antibody (10599-1-AP, Proteintech, WB: 1:2000; IP: 1:1000; IF: 1:100), rabbit-anti-MMP2 antibody (10373-2-AP, Proteintech, WB: 1:1000), rabbit-anti-MMP9 antibody (10375-2-AP, Proteintech, WB: 1:1000), rabbit-anti-PCNA antibody (10205-2-AP, Proteintech, WB: 1:1000), mouse-anti-Tubulin antibody (66031-1-Ig, Proteintech, WB: 1:1000), mouse-antiGAPDH antibody (60004-1-Ig, Proteintech, WB: 1:1000), mouse-anti-Flag antibody (66008-4-Ig, Proteintech, WB: 1:1000; IP: 1:1000), rabbit-anti-JAK2 antibody (3230 S, CST, WB: 1:1000), rabbit-anti-p-JAK2 antibody (3776 S, CST, WB: 1:1000), mouse-anti-STAT3 antibody (9139 S, CST, WB: 1:1000; IP: 1:1000), rabbit-anti-p-STAT3(705) antibody (9145 S, CST, WB: 1:1000; IF: 1:100), rabbit-anti-p-STAT3(727) antibody (94,994 S, CST, WB: 1:1000; IF: 1:100), mouse-anti-ERK1/2 antibody (sc514,302, Santa, WB: 1:1000), mouse-anti-p-ERK1/2 antibody (sc-81,492, Santa, WB: 1:1000), mouse-anti-GATA3 antibody (66400-1-Ig, Proteintech, WB: 1:1000), HRP goat-anti-rabbit IgG antibody (A21020, Abbkine, WB: 1:10000), HRP goat-anti-mouse IgG antibody (A21010, Abbkine, WB: 1:10000), Rhodamine(TRITIC) conjugated goat-anti-rabbit IgG(H + L) (SA00007-2, Proteintech, IF: 1:200), Protein A/G magnetic Beads (Cat#B23202, Biotool), AntiFade Mounting Medium (Beyotime), CCK-8 cell viability kit (B34304, Bimake), Higene transfection reagent (C1506, APPLYGEN), Jet kit (101,000,046, Polyplus), protease inhibitor (B14001, Bimake), phosphatase inhibitors (B15001, Bimake), SH-4-54 (S7337, Selleck), U0126-EtOH (S1102, Selleck). ..



    Similar Products

    rabbit anti p jak2 primary antibody  (Bioss)
    94
    Bioss rabbit anti p jak2 primary antibody
    Effect of RRTS on <t>JAK2/STAT3</t> pathway. (A–C) Relative protein expression of p-JAK2, p-STAT3, JAK2, and STAT3. (D) mRNA expression of JAK2 and STAT3. Data were shown as the mean ± SD of three independent experiments. Compared with control group, * P < 0.05, ** P < 0.01.
    Rabbit Anti P Jak2 Primary Antibody, supplied by Bioss, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+anti+p+jak2+antibody/JAK2(Tyr221)+Polyclonal+Antibody/pmc12062126-29-96-100
    Average 94 stars, based on 1 article reviews
    rabbit anti p jak2 primary antibody - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    rabbit anti p jak2 antibody  (Cell Signaling Technology Inc)
    96
    Cell Signaling Technology Inc rabbit anti p jak2 antibody
    Effect of RRTS on <t>JAK2/STAT3</t> pathway. (A–C) Relative protein expression of p-JAK2, p-STAT3, JAK2, and STAT3. (D) mRNA expression of JAK2 and STAT3. Data were shown as the mean ± SD of three independent experiments. Compared with control group, * P < 0.05, ** P < 0.01.
    Rabbit Anti P Jak2 Antibody, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+anti+p+jak2+antibody/Phospho-Jak2+(Tyr1007%2F1008)+Antibody/10__1134_slash_s160767292560160x-56-13-18
    Average 96 stars, based on 1 article reviews
    rabbit anti p jak2 antibody - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    rabbit anti p jak2  (Cell Signaling Technology Inc)
    96
    Cell Signaling Technology Inc rabbit anti p jak2
    Effect of RRTS on <t>JAK2/STAT3</t> pathway. (A–C) Relative protein expression of p-JAK2, p-STAT3, JAK2, and STAT3. (D) mRNA expression of JAK2 and STAT3. Data were shown as the mean ± SD of three independent experiments. Compared with control group, * P < 0.05, ** P < 0.01.
    Rabbit Anti P Jak2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+anti+p+jak2+antibody/Phospho-Jak2+(Tyr1007%2F1008)+Antibody/pmc12580595-105-70-82
    Average 96 stars, based on 1 article reviews
    rabbit anti p jak2 - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    primary antibodies against p jak2  (Cell Signaling Technology Inc)
    96
    Cell Signaling Technology Inc primary antibodies against p jak2
    Effect of RRTS on <t>JAK2/STAT3</t> pathway. (A–C) Relative protein expression of p-JAK2, p-STAT3, JAK2, and STAT3. (D) mRNA expression of JAK2 and STAT3. Data were shown as the mean ± SD of three independent experiments. Compared with control group, * P < 0.05, ** P < 0.01.
    Primary Antibodies Against P Jak2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+anti+p+jak2+antibody/Jak2+XP+Rabbit+mAb/pm40328339-66-0-6
    Average 96 stars, based on 1 article reviews
    primary antibodies against p jak2 - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    p jak2 antibodies  (Cell Signaling Technology Inc)
    98
    Cell Signaling Technology Inc p jak2 antibodies
    Fig. 1. Experimental flow. Notes: 5-HT: 5-hydroxytryptamine; ACTH: adrenocorticotropic hormone; BDNF: brain-derived neurotrophic factor; CORT: corticosterone; CREB: cAMP-response element-binding; CUMS: chronic unpredictable mild stress; DA: dopamine; H&E: hematoxylineeosin; <t>JAK2:</t> Janus kinase 2; NE: norepinephrine; p-JAK2: phosphorylated JAK2; p-STAT3: phos- phorylated STAT3; SPT: sucrose preference test; STAT3: signal transducer and activator of transcription 3; WKY: Wistar Kyoto.
    P Jak2 Antibodies, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+anti+p+jak2+antibody/Phospho-Stat3+(Tyr705)+XP+Rabbit+mAb/10__1016_slash_j__jtcms__2025__05__002-58-11-16
    Average 98 stars, based on 1 article reviews
    p jak2 antibodies - by Bioz Stars, 2026-09
    98/100 stars
    		  Buy from Supplier
    anti p jak2 antibody  (Cell Signaling Technology Inc)
    99
    Cell Signaling Technology Inc anti p jak2 antibody
    Fig. 1. Experimental flow. Notes: 5-HT: 5-hydroxytryptamine; ACTH: adrenocorticotropic hormone; BDNF: brain-derived neurotrophic factor; CORT: corticosterone; CREB: cAMP-response element-binding; CUMS: chronic unpredictable mild stress; DA: dopamine; H&E: hematoxylineeosin; <t>JAK2:</t> Janus kinase 2; NE: norepinephrine; p-JAK2: phosphorylated JAK2; p-STAT3: phos- phorylated STAT3; SPT: sucrose preference test; STAT3: signal transducer and activator of transcription 3; WKY: Wistar Kyoto.
    Anti P Jak2 Antibody, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+anti+p+jak2+antibody/beta-Actin+Rabbit+mAb/pm40174532-82-16-21
    Average 99 stars, based on 1 article reviews
    anti p jak2 antibody - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    rabbit anti p jak2  (Santa Cruz Biotechnology)
    96
    Santa Cruz Biotechnology rabbit anti p jak2
    Fig. 1. Experimental flow. Notes: 5-HT: 5-hydroxytryptamine; ACTH: adrenocorticotropic hormone; BDNF: brain-derived neurotrophic factor; CORT: corticosterone; CREB: cAMP-response element-binding; CUMS: chronic unpredictable mild stress; DA: dopamine; H&E: hematoxylineeosin; <t>JAK2:</t> Janus kinase 2; NE: norepinephrine; p-JAK2: phosphorylated JAK2; p-STAT3: phos- phorylated STAT3; SPT: sucrose preference test; STAT3: signal transducer and activator of transcription 3; WKY: Wistar Kyoto.
    Rabbit Anti P Jak2, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+anti+p+jak2+antibody/JAK2+Antibody/pm39396691-88-77-80
    Average 96 stars, based on 1 article reviews
    rabbit anti p jak2 - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    antibodies against p jak2  (Cell Signaling Technology Inc)
    96
    Cell Signaling Technology Inc antibodies against p jak2
    Fig. 1. Experimental flow. Notes: 5-HT: 5-hydroxytryptamine; ACTH: adrenocorticotropic hormone; BDNF: brain-derived neurotrophic factor; CORT: corticosterone; CREB: cAMP-response element-binding; CUMS: chronic unpredictable mild stress; DA: dopamine; H&E: hematoxylineeosin; <t>JAK2:</t> Janus kinase 2; NE: norepinephrine; p-JAK2: phosphorylated JAK2; p-STAT3: phos- phorylated STAT3; SPT: sucrose preference test; STAT3: signal transducer and activator of transcription 3; WKY: Wistar Kyoto.
    Antibodies Against P Jak2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+anti+p+jak2+antibody/Jak2+XP+Rabbit+mAb/pm38925513-40-0-26
    Average 96 stars, based on 1 article reviews
    antibodies against p jak2 - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier

    Image Search Results


    Effect of RRTS on JAK2/STAT3 pathway. (A–C) Relative protein expression of p-JAK2, p-STAT3, JAK2, and STAT3. (D) mRNA expression of JAK2 and STAT3. Data were shown as the mean ± SD of three independent experiments. Compared with control group, * P < 0.05, ** P < 0.01.

    Journal: Frontiers in Pharmacology

    Article Title: Mechanism of total saponins of Ranunculus ternatus Thunb. in treatment of breast cancer based on liquid chromatography–mass spectrometry and network analysis

    doi: 10.3389/fphar.2025.1506885

    Figure Lengend Snippet: Effect of RRTS on JAK2/STAT3 pathway. (A–C) Relative protein expression of p-JAK2, p-STAT3, JAK2, and STAT3. (D) mRNA expression of JAK2 and STAT3. Data were shown as the mean ± SD of three independent experiments. Compared with control group, * P < 0.05, ** P < 0.01.

    Article Snippet: The following supplies were used: Eleutheroside A standard (Chengdu Pusi Biotechnology; PS0811-0025); R. ternatus Thunb.plant medicine (Xinyang, Henan Province); a mouse IL-6 kit (Suzhou Calvin Biotechnology CK-E20012M); a mouse TNF-α kit (CK-E20220M); a mouse IL-10 kit (CK-E20206M); a human IL-6 kit (Suzhou Calvin Biotechnology Co., Ltd.; CK-E20665M); a human TNF-α kit (CK-E20036M); a human IL-10 kit (CK-E20667M); fetal bovine serum (Ausbian; S711-001S); RPMI-1640 basic medium with dual antibiotics (Wuhan Procell Life Science & Technology; PM150110A); rabbit anti-Bax primary antibody (Beijing Bioss; bs-0127R); rabbit anti-Bcl-2 primary antibody (Beijing Bioss; bs-4563R); rabbit GAPDH (GAPDH; Wuhan Sanying Biotechnology; GB-15004); rabbit anti-p-JAK2 primary antibody (Bioss; bs-3206R); Goat Anti-Rabbit IgG H&L antibody (Bioss; bs-40295G-IRDye800CW); primer sequence information 5′–3′ primer sequence: Mouse GAPDH (Forward: CCT​CGT​CCC​GTA​GAC​AAA​ATG, Reverse: TGA​GGT​CAA​TGA​AGG​GGT​CGT); Mouse JAK2 (Forward: GTG​CTT​TTG​AAG​ACA​GGG​ACC, Reverse: GGG​TCA​TAG​CGG​CAC​ATC​TC); MouseSTAT3(Forward:TGCGGAGAAGCATTGTGAGTG, Reverse: TCT​TAA​TTT​GTT​GGC​GGG​TCT); Human GAPDH (Forward: GGA​AGC​TTG​TCA​TCA​ATG​GAA​ATC, Reverse: TGA​TGA​CCC​TTT​TGG​CTC​CC); Human JAK2 (Forward: GGC​CTT​CTT​TCA​GAG​CCA​TCA, Reverse: TTT​TAC​AGC​GAC​CAC​CTC​CC); Human STAT3 (Forward: CTC​AAC​TAT​CTG​GAG​GAC​AAA​GGC, Reverse: TGA​CGC​CAC​TAA​ACA​CTT​CCC); Human Bax (Forward: CGG​GTT​GTC​GCC​CTT​TTC​TA, Reverse: GAG​GAA​GTC​CAA​TGT​CCA​GCC); Human Bcl-2 (Forward: GGA​GGA​TTG​TGG​CCT​TCT​TTG, Reverse: GCA​TCC​CAG​CCT​CCG​TTA​TC); microplate reader (BIO-RAD, United States; BIO-RAD680).

    Techniques: Expressing, Control

    Effect of RRTS on the growth of MCF-7 cell (A) Effect on proliferation of MCF-7 cells. (B, C) Effect on MCF-7 cell migration. (D) Effects on inflammatory cytokines IL-6,TNF-α and IL-10. (E) The apoptosis rate of the cells was detected by flow cytometry (Annexin V-FITC/PI method). (F) mRNA expression of JAK2 and STAT3. (G, H) Protein expression of proteins Bax, Bcl-2, JAK2, p-JAK2, STAT3 and p-STAT3. Data were shown as the mean ± SD of three independent experiments. Compared with control group, * P < 0.05, ** P < 0.01.

    Journal: Frontiers in Pharmacology

    Article Title: Mechanism of total saponins of Ranunculus ternatus Thunb. in treatment of breast cancer based on liquid chromatography–mass spectrometry and network analysis

    doi: 10.3389/fphar.2025.1506885

    Figure Lengend Snippet: Effect of RRTS on the growth of MCF-7 cell (A) Effect on proliferation of MCF-7 cells. (B, C) Effect on MCF-7 cell migration. (D) Effects on inflammatory cytokines IL-6,TNF-α and IL-10. (E) The apoptosis rate of the cells was detected by flow cytometry (Annexin V-FITC/PI method). (F) mRNA expression of JAK2 and STAT3. (G, H) Protein expression of proteins Bax, Bcl-2, JAK2, p-JAK2, STAT3 and p-STAT3. Data were shown as the mean ± SD of three independent experiments. Compared with control group, * P < 0.05, ** P < 0.01.

    Article Snippet: The following supplies were used: Eleutheroside A standard (Chengdu Pusi Biotechnology; PS0811-0025); R. ternatus Thunb.plant medicine (Xinyang, Henan Province); a mouse IL-6 kit (Suzhou Calvin Biotechnology CK-E20012M); a mouse TNF-α kit (CK-E20220M); a mouse IL-10 kit (CK-E20206M); a human IL-6 kit (Suzhou Calvin Biotechnology Co., Ltd.; CK-E20665M); a human TNF-α kit (CK-E20036M); a human IL-10 kit (CK-E20667M); fetal bovine serum (Ausbian; S711-001S); RPMI-1640 basic medium with dual antibiotics (Wuhan Procell Life Science & Technology; PM150110A); rabbit anti-Bax primary antibody (Beijing Bioss; bs-0127R); rabbit anti-Bcl-2 primary antibody (Beijing Bioss; bs-4563R); rabbit GAPDH (GAPDH; Wuhan Sanying Biotechnology; GB-15004); rabbit anti-p-JAK2 primary antibody (Bioss; bs-3206R); Goat Anti-Rabbit IgG H&L antibody (Bioss; bs-40295G-IRDye800CW); primer sequence information 5′–3′ primer sequence: Mouse GAPDH (Forward: CCT​CGT​CCC​GTA​GAC​AAA​ATG, Reverse: TGA​GGT​CAA​TGA​AGG​GGT​CGT); Mouse JAK2 (Forward: GTG​CTT​TTG​AAG​ACA​GGG​ACC, Reverse: GGG​TCA​TAG​CGG​CAC​ATC​TC); MouseSTAT3(Forward:TGCGGAGAAGCATTGTGAGTG, Reverse: TCT​TAA​TTT​GTT​GGC​GGG​TCT); Human GAPDH (Forward: GGA​AGC​TTG​TCA​TCA​ATG​GAA​ATC, Reverse: TGA​TGA​CCC​TTT​TGG​CTC​CC); Human JAK2 (Forward: GGC​CTT​CTT​TCA​GAG​CCA​TCA, Reverse: TTT​TAC​AGC​GAC​CAC​CTC​CC); Human STAT3 (Forward: CTC​AAC​TAT​CTG​GAG​GAC​AAA​GGC, Reverse: TGA​CGC​CAC​TAA​ACA​CTT​CCC); Human Bax (Forward: CGG​GTT​GTC​GCC​CTT​TTC​TA, Reverse: GAG​GAA​GTC​CAA​TGT​CCA​GCC); Human Bcl-2 (Forward: GGA​GGA​TTG​TGG​CCT​TCT​TTG, Reverse: GCA​TCC​CAG​CCT​CCG​TTA​TC); microplate reader (BIO-RAD, United States; BIO-RAD680).

    Techniques: Migration, Flow Cytometry, Expressing, Control

    JAK2/STAT3 pathway inhibition as potential mechanism of Ranunculus ternatus Thunb. For the treatment of breast cancer.

    Journal: Frontiers in Pharmacology

    Article Title: Mechanism of total saponins of Ranunculus ternatus Thunb. in treatment of breast cancer based on liquid chromatography–mass spectrometry and network analysis

    doi: 10.3389/fphar.2025.1506885

    Figure Lengend Snippet: JAK2/STAT3 pathway inhibition as potential mechanism of Ranunculus ternatus Thunb. For the treatment of breast cancer.

    Article Snippet: The following supplies were used: Eleutheroside A standard (Chengdu Pusi Biotechnology; PS0811-0025); R. ternatus Thunb.plant medicine (Xinyang, Henan Province); a mouse IL-6 kit (Suzhou Calvin Biotechnology CK-E20012M); a mouse TNF-α kit (CK-E20220M); a mouse IL-10 kit (CK-E20206M); a human IL-6 kit (Suzhou Calvin Biotechnology Co., Ltd.; CK-E20665M); a human TNF-α kit (CK-E20036M); a human IL-10 kit (CK-E20667M); fetal bovine serum (Ausbian; S711-001S); RPMI-1640 basic medium with dual antibiotics (Wuhan Procell Life Science & Technology; PM150110A); rabbit anti-Bax primary antibody (Beijing Bioss; bs-0127R); rabbit anti-Bcl-2 primary antibody (Beijing Bioss; bs-4563R); rabbit GAPDH (GAPDH; Wuhan Sanying Biotechnology; GB-15004); rabbit anti-p-JAK2 primary antibody (Bioss; bs-3206R); Goat Anti-Rabbit IgG H&L antibody (Bioss; bs-40295G-IRDye800CW); primer sequence information 5′–3′ primer sequence: Mouse GAPDH (Forward: CCT​CGT​CCC​GTA​GAC​AAA​ATG, Reverse: TGA​GGT​CAA​TGA​AGG​GGT​CGT); Mouse JAK2 (Forward: GTG​CTT​TTG​AAG​ACA​GGG​ACC, Reverse: GGG​TCA​TAG​CGG​CAC​ATC​TC); MouseSTAT3(Forward:TGCGGAGAAGCATTGTGAGTG, Reverse: TCT​TAA​TTT​GTT​GGC​GGG​TCT); Human GAPDH (Forward: GGA​AGC​TTG​TCA​TCA​ATG​GAA​ATC, Reverse: TGA​TGA​CCC​TTT​TGG​CTC​CC); Human JAK2 (Forward: GGC​CTT​CTT​TCA​GAG​CCA​TCA, Reverse: TTT​TAC​AGC​GAC​CAC​CTC​CC); Human STAT3 (Forward: CTC​AAC​TAT​CTG​GAG​GAC​AAA​GGC, Reverse: TGA​CGC​CAC​TAA​ACA​CTT​CCC); Human Bax (Forward: CGG​GTT​GTC​GCC​CTT​TTC​TA, Reverse: GAG​GAA​GTC​CAA​TGT​CCA​GCC); Human Bcl-2 (Forward: GGA​GGA​TTG​TGG​CCT​TCT​TTG, Reverse: GCA​TCC​CAG​CCT​CCG​TTA​TC); microplate reader (BIO-RAD, United States; BIO-RAD680).

    Techniques: Inhibition

    Fig. 1. Experimental flow. Notes: 5-HT: 5-hydroxytryptamine; ACTH: adrenocorticotropic hormone; BDNF: brain-derived neurotrophic factor; CORT: corticosterone; CREB: cAMP-response element-binding; CUMS: chronic unpredictable mild stress; DA: dopamine; H&E: hematoxylineeosin; JAK2: Janus kinase 2; NE: norepinephrine; p-JAK2: phosphorylated JAK2; p-STAT3: phos- phorylated STAT3; SPT: sucrose preference test; STAT3: signal transducer and activator of transcription 3; WKY: Wistar Kyoto.

    Journal: Journal of Traditional Chinese Medical Sciences

    Article Title: Antidepressant effects and mechanisms of Wuhua herbal tea in a rat model of chronic unpredictable mild stress

    doi: 10.1016/j.jtcms.2025.05.002

    Figure Lengend Snippet: Fig. 1. Experimental flow. Notes: 5-HT: 5-hydroxytryptamine; ACTH: adrenocorticotropic hormone; BDNF: brain-derived neurotrophic factor; CORT: corticosterone; CREB: cAMP-response element-binding; CUMS: chronic unpredictable mild stress; DA: dopamine; H&E: hematoxylineeosin; JAK2: Janus kinase 2; NE: norepinephrine; p-JAK2: phosphorylated JAK2; p-STAT3: phos- phorylated STAT3; SPT: sucrose preference test; STAT3: signal transducer and activator of transcription 3; WKY: Wistar Kyoto.

    Article Snippet: Phosphorylated STAT3 antibodies were purchased from Abcam (ab32101; Cambridge, MA) and p-JAK2 antibodies were purchased from Cell Signaling Technology (9145; Danvers, MA).

    Techniques: Derivative Assay, Binding Assay

    Fig. 9. p-JAK2 and p-STAT3 expression levels in CUMS rats by using IHC: (A) IHC slices. (B and C): positive area of p-JAK2 and p-STAT3. Notes: CUMS: chronic unpredictable mild stress; IHC: immunohistochemistry; p-JAK2: phosphorylated Janus kinase 2; p-STAT3: phosphorylated signal transducer and activator of transcription 3. Data are expressed as mean (standard deviation) (n ¼ 3). ***P < .001 between the control and model groups; ##P < .01 between the model and fluoxetine groups;

    Journal: Journal of Traditional Chinese Medical Sciences

    Article Title: Antidepressant effects and mechanisms of Wuhua herbal tea in a rat model of chronic unpredictable mild stress

    doi: 10.1016/j.jtcms.2025.05.002

    Figure Lengend Snippet: Fig. 9. p-JAK2 and p-STAT3 expression levels in CUMS rats by using IHC: (A) IHC slices. (B and C): positive area of p-JAK2 and p-STAT3. Notes: CUMS: chronic unpredictable mild stress; IHC: immunohistochemistry; p-JAK2: phosphorylated Janus kinase 2; p-STAT3: phosphorylated signal transducer and activator of transcription 3. Data are expressed as mean (standard deviation) (n ¼ 3). ***P < .001 between the control and model groups; ##P < .01 between the model and fluoxetine groups;

    Article Snippet: Phosphorylated STAT3 antibodies were purchased from Abcam (ab32101; Cambridge, MA) and p-JAK2 antibodies were purchased from Cell Signaling Technology (9145; Danvers, MA).

    Techniques: Expressing, Immunohistochemistry, Standard Deviation, Control

    Fig. 10. mRNA expression levels of (A) BDNF, (B) CREB, (C) JAK2, and (D) STAT3 in CUMS rat hippocampus among the four groups. Notes: BDNF, brain-derived neurotrophic factor; CREB: cAMP-response element-binding; CUMS, chronic unpredictable mild stress; mRNA: messenger RNA; JAK2: Janus kinase 2; STAT3: signal transducer and activator of transcription 3. Data are expressed as mean (standard deviation) (n ¼ 3). **P < .01 and ***P < .001 between the control and model groups; ##P < .01 and ###P < .001 between the model and fluoxetine groups; AP < .05 and AAP < .01 between the model and Wuhua herbal tea groups.

    Journal: Journal of Traditional Chinese Medical Sciences

    Article Title: Antidepressant effects and mechanisms of Wuhua herbal tea in a rat model of chronic unpredictable mild stress

    doi: 10.1016/j.jtcms.2025.05.002

    Figure Lengend Snippet: Fig. 10. mRNA expression levels of (A) BDNF, (B) CREB, (C) JAK2, and (D) STAT3 in CUMS rat hippocampus among the four groups. Notes: BDNF, brain-derived neurotrophic factor; CREB: cAMP-response element-binding; CUMS, chronic unpredictable mild stress; mRNA: messenger RNA; JAK2: Janus kinase 2; STAT3: signal transducer and activator of transcription 3. Data are expressed as mean (standard deviation) (n ¼ 3). **P < .01 and ***P < .001 between the control and model groups; ##P < .01 and ###P < .001 between the model and fluoxetine groups; AP < .05 and AAP < .01 between the model and Wuhua herbal tea groups.

    Article Snippet: Phosphorylated STAT3 antibodies were purchased from Abcam (ab32101; Cambridge, MA) and p-JAK2 antibodies were purchased from Cell Signaling Technology (9145; Danvers, MA).

    Techniques: Expressing, Derivative Assay, Binding Assay, Standard Deviation, Control