rabbit anti p jak2 antibody  (Cell Signaling Technology Inc)

Journal: Frontiers in Pharmacology

Article Title: Mechanism of total saponins of Ranunculus ternatus Thunb. in treatment of breast cancer based on liquid chromatography–mass spectrometry and network analysis

doi: 10.3389/fphar.2025.1506885

Figure Lengend Snippet: Effect of RRTS on JAK2/STAT3 pathway. (A–C) Relative protein expression of p-JAK2, p-STAT3, JAK2, and STAT3. (D) mRNA expression of JAK2 and STAT3. Data were shown as the mean ± SD of three independent experiments. Compared with control group, * P < 0.05, ** P < 0.01.

Article Snippet: The following supplies were used: Eleutheroside A standard (Chengdu Pusi Biotechnology; PS0811-0025); R. ternatus Thunb.plant medicine (Xinyang, Henan Province); a mouse IL-6 kit (Suzhou Calvin Biotechnology CK-E20012M); a mouse TNF-α kit (CK-E20220M); a mouse IL-10 kit (CK-E20206M); a human IL-6 kit (Suzhou Calvin Biotechnology Co., Ltd.; CK-E20665M); a human TNF-α kit (CK-E20036M); a human IL-10 kit (CK-E20667M); fetal bovine serum (Ausbian; S711-001S); RPMI-1640 basic medium with dual antibiotics (Wuhan Procell Life Science & Technology; PM150110A); rabbit anti-Bax primary antibody (Beijing Bioss; bs-0127R); rabbit anti-Bcl-2 primary antibody (Beijing Bioss; bs-4563R); rabbit GAPDH (GAPDH; Wuhan Sanying Biotechnology; GB-15004); rabbit anti-p-JAK2 primary antibody (Bioss; bs-3206R); Goat Anti-Rabbit IgG H&L antibody (Bioss; bs-40295G-IRDye800CW); primer sequence information 5′–3′ primer sequence: Mouse GAPDH (Forward: CCT​CGT​CCC​GTA​GAC​AAA​ATG, Reverse: TGA​GGT​CAA​TGA​AGG​GGT​CGT); Mouse JAK2 (Forward: GTG​CTT​TTG​AAG​ACA​GGG​ACC, Reverse: GGG​TCA​TAG​CGG​CAC​ATC​TC); MouseSTAT3(Forward:TGCGGAGAAGCATTGTGAGTG, Reverse: TCT​TAA​TTT​GTT​GGC​GGG​TCT); Human GAPDH (Forward: GGA​AGC​TTG​TCA​TCA​ATG​GAA​ATC, Reverse: TGA​TGA​CCC​TTT​TGG​CTC​CC); Human JAK2 (Forward: GGC​CTT​CTT​TCA​GAG​CCA​TCA, Reverse: TTT​TAC​AGC​GAC​CAC​CTC​CC); Human STAT3 (Forward: CTC​AAC​TAT​CTG​GAG​GAC​AAA​GGC, Reverse: TGA​CGC​CAC​TAA​ACA​CTT​CCC); Human Bax (Forward: CGG​GTT​GTC​GCC​CTT​TTC​TA, Reverse: GAG​GAA​GTC​CAA​TGT​CCA​GCC); Human Bcl-2 (Forward: GGA​GGA​TTG​TGG​CCT​TCT​TTG, Reverse: GCA​TCC​CAG​CCT​CCG​TTA​TC); microplate reader (BIO-RAD, United States; BIO-RAD680).

Techniques: Expressing, Control

Journal: Frontiers in Pharmacology

Article Title: Mechanism of total saponins of Ranunculus ternatus Thunb. in treatment of breast cancer based on liquid chromatography–mass spectrometry and network analysis

doi: 10.3389/fphar.2025.1506885

Figure Lengend Snippet: Effect of RRTS on the growth of MCF-7 cell (A) Effect on proliferation of MCF-7 cells. (B, C) Effect on MCF-7 cell migration. (D) Effects on inflammatory cytokines IL-6,TNF-α and IL-10. (E) The apoptosis rate of the cells was detected by flow cytometry (Annexin V-FITC/PI method). (F) mRNA expression of JAK2 and STAT3. (G, H) Protein expression of proteins Bax, Bcl-2, JAK2, p-JAK2, STAT3 and p-STAT3. Data were shown as the mean ± SD of three independent experiments. Compared with control group, * P < 0.05, ** P < 0.01.

Article Snippet: The following supplies were used: Eleutheroside A standard (Chengdu Pusi Biotechnology; PS0811-0025); R. ternatus Thunb.plant medicine (Xinyang, Henan Province); a mouse IL-6 kit (Suzhou Calvin Biotechnology CK-E20012M); a mouse TNF-α kit (CK-E20220M); a mouse IL-10 kit (CK-E20206M); a human IL-6 kit (Suzhou Calvin Biotechnology Co., Ltd.; CK-E20665M); a human TNF-α kit (CK-E20036M); a human IL-10 kit (CK-E20667M); fetal bovine serum (Ausbian; S711-001S); RPMI-1640 basic medium with dual antibiotics (Wuhan Procell Life Science & Technology; PM150110A); rabbit anti-Bax primary antibody (Beijing Bioss; bs-0127R); rabbit anti-Bcl-2 primary antibody (Beijing Bioss; bs-4563R); rabbit GAPDH (GAPDH; Wuhan Sanying Biotechnology; GB-15004); rabbit anti-p-JAK2 primary antibody (Bioss; bs-3206R); Goat Anti-Rabbit IgG H&L antibody (Bioss; bs-40295G-IRDye800CW); primer sequence information 5′–3′ primer sequence: Mouse GAPDH (Forward: CCT​CGT​CCC​GTA​GAC​AAA​ATG, Reverse: TGA​GGT​CAA​TGA​AGG​GGT​CGT); Mouse JAK2 (Forward: GTG​CTT​TTG​AAG​ACA​GGG​ACC, Reverse: GGG​TCA​TAG​CGG​CAC​ATC​TC); MouseSTAT3(Forward:TGCGGAGAAGCATTGTGAGTG, Reverse: TCT​TAA​TTT​GTT​GGC​GGG​TCT); Human GAPDH (Forward: GGA​AGC​TTG​TCA​TCA​ATG​GAA​ATC, Reverse: TGA​TGA​CCC​TTT​TGG​CTC​CC); Human JAK2 (Forward: GGC​CTT​CTT​TCA​GAG​CCA​TCA, Reverse: TTT​TAC​AGC​GAC​CAC​CTC​CC); Human STAT3 (Forward: CTC​AAC​TAT​CTG​GAG​GAC​AAA​GGC, Reverse: TGA​CGC​CAC​TAA​ACA​CTT​CCC); Human Bax (Forward: CGG​GTT​GTC​GCC​CTT​TTC​TA, Reverse: GAG​GAA​GTC​CAA​TGT​CCA​GCC); Human Bcl-2 (Forward: GGA​GGA​TTG​TGG​CCT​TCT​TTG, Reverse: GCA​TCC​CAG​CCT​CCG​TTA​TC); microplate reader (BIO-RAD, United States; BIO-RAD680).

Techniques: Migration, Flow Cytometry, Expressing, Control

Journal: Frontiers in Pharmacology

Article Title: Mechanism of total saponins of Ranunculus ternatus Thunb. in treatment of breast cancer based on liquid chromatography–mass spectrometry and network analysis

doi: 10.3389/fphar.2025.1506885

Figure Lengend Snippet: JAK2/STAT3 pathway inhibition as potential mechanism of Ranunculus ternatus Thunb. For the treatment of breast cancer.

Article Snippet: The following supplies were used: Eleutheroside A standard (Chengdu Pusi Biotechnology; PS0811-0025); R. ternatus Thunb.plant medicine (Xinyang, Henan Province); a mouse IL-6 kit (Suzhou Calvin Biotechnology CK-E20012M); a mouse TNF-α kit (CK-E20220M); a mouse IL-10 kit (CK-E20206M); a human IL-6 kit (Suzhou Calvin Biotechnology Co., Ltd.; CK-E20665M); a human TNF-α kit (CK-E20036M); a human IL-10 kit (CK-E20667M); fetal bovine serum (Ausbian; S711-001S); RPMI-1640 basic medium with dual antibiotics (Wuhan Procell Life Science & Technology; PM150110A); rabbit anti-Bax primary antibody (Beijing Bioss; bs-0127R); rabbit anti-Bcl-2 primary antibody (Beijing Bioss; bs-4563R); rabbit GAPDH (GAPDH; Wuhan Sanying Biotechnology; GB-15004); rabbit anti-p-JAK2 primary antibody (Bioss; bs-3206R); Goat Anti-Rabbit IgG H&L antibody (Bioss; bs-40295G-IRDye800CW); primer sequence information 5′–3′ primer sequence: Mouse GAPDH (Forward: CCT​CGT​CCC​GTA​GAC​AAA​ATG, Reverse: TGA​GGT​CAA​TGA​AGG​GGT​CGT); Mouse JAK2 (Forward: GTG​CTT​TTG​AAG​ACA​GGG​ACC, Reverse: GGG​TCA​TAG​CGG​CAC​ATC​TC); MouseSTAT3(Forward:TGCGGAGAAGCATTGTGAGTG, Reverse: TCT​TAA​TTT​GTT​GGC​GGG​TCT); Human GAPDH (Forward: GGA​AGC​TTG​TCA​TCA​ATG​GAA​ATC, Reverse: TGA​TGA​CCC​TTT​TGG​CTC​CC); Human JAK2 (Forward: GGC​CTT​CTT​TCA​GAG​CCA​TCA, Reverse: TTT​TAC​AGC​GAC​CAC​CTC​CC); Human STAT3 (Forward: CTC​AAC​TAT​CTG​GAG​GAC​AAA​GGC, Reverse: TGA​CGC​CAC​TAA​ACA​CTT​CCC); Human Bax (Forward: CGG​GTT​GTC​GCC​CTT​TTC​TA, Reverse: GAG​GAA​GTC​CAA​TGT​CCA​GCC); Human Bcl-2 (Forward: GGA​GGA​TTG​TGG​CCT​TCT​TTG, Reverse: GCA​TCC​CAG​CCT​CCG​TTA​TC); microplate reader (BIO-RAD, United States; BIO-RAD680).

Techniques: Inhibition

Journal: Journal of Traditional Chinese Medical Sciences

Article Title: Antidepressant effects and mechanisms of Wuhua herbal tea in a rat model of chronic unpredictable mild stress

doi: 10.1016/j.jtcms.2025.05.002

Figure Lengend Snippet: Fig. 1. Experimental flow. Notes: 5-HT: 5-hydroxytryptamine; ACTH: adrenocorticotropic hormone; BDNF: brain-derived neurotrophic factor; CORT: corticosterone; CREB: cAMP-response element-binding; CUMS: chronic unpredictable mild stress; DA: dopamine; H&E: hematoxylineeosin; JAK2: Janus kinase 2; NE: norepinephrine; p-JAK2: phosphorylated JAK2; p-STAT3: phos- phorylated STAT3; SPT: sucrose preference test; STAT3: signal transducer and activator of transcription 3; WKY: Wistar Kyoto.

Article Snippet: Phosphorylated STAT3 antibodies were purchased from Abcam (ab32101; Cambridge, MA) and p-JAK2 antibodies were purchased from Cell Signaling Technology (9145; Danvers, MA).

Techniques: Derivative Assay, Binding Assay

Journal: Journal of Traditional Chinese Medical Sciences

Article Title: Antidepressant effects and mechanisms of Wuhua herbal tea in a rat model of chronic unpredictable mild stress

doi: 10.1016/j.jtcms.2025.05.002

Figure Lengend Snippet: Fig. 9. p-JAK2 and p-STAT3 expression levels in CUMS rats by using IHC: (A) IHC slices. (B and C): positive area of p-JAK2 and p-STAT3. Notes: CUMS: chronic unpredictable mild stress; IHC: immunohistochemistry; p-JAK2: phosphorylated Janus kinase 2; p-STAT3: phosphorylated signal transducer and activator of transcription 3. Data are expressed as mean (standard deviation) (n ¼ 3). ***P < .001 between the control and model groups; ##P < .01 between the model and fluoxetine groups;

Article Snippet: Phosphorylated STAT3 antibodies were purchased from Abcam (ab32101; Cambridge, MA) and p-JAK2 antibodies were purchased from Cell Signaling Technology (9145; Danvers, MA).

Techniques: Expressing, Immunohistochemistry, Standard Deviation, Control

Journal: Journal of Traditional Chinese Medical Sciences

Article Title: Antidepressant effects and mechanisms of Wuhua herbal tea in a rat model of chronic unpredictable mild stress

doi: 10.1016/j.jtcms.2025.05.002

Figure Lengend Snippet: Fig. 10. mRNA expression levels of (A) BDNF, (B) CREB, (C) JAK2, and (D) STAT3 in CUMS rat hippocampus among the four groups. Notes: BDNF, brain-derived neurotrophic factor; CREB: cAMP-response element-binding; CUMS, chronic unpredictable mild stress; mRNA: messenger RNA; JAK2: Janus kinase 2; STAT3: signal transducer and activator of transcription 3. Data are expressed as mean (standard deviation) (n ¼ 3). **P < .01 and ***P < .001 between the control and model groups; ##P < .01 and ###P < .001 between the model and fluoxetine groups; AP < .05 and AAP < .01 between the model and Wuhua herbal tea groups.

Article Snippet: Phosphorylated STAT3 antibodies were purchased from Abcam (ab32101; Cambridge, MA) and p-JAK2 antibodies were purchased from Cell Signaling Technology (9145; Danvers, MA).

Techniques: Expressing, Derivative Assay, Binding Assay, Standard Deviation, Control

Journal: Scientific Reports

Article Title: Effect of scutellarin on BV-2 microglial-mediated apoptosis in PC12 cells via JAK2/STAT3 signalling pathway

doi: 10.1038/s41598-024-64226-x

Figure Lengend Snippet: Expression changes involving JAK2/STAT3 pathway-related proteins in PC12 cells. ( A ) Bands of western blotting. ( B ) Bar chart of protein expression. ( C ) Images of immunofluorescent staining, Scale bar: 50 µm. ( D ) Bars of fluorescence intensity quantification. Data are shown as means ± standard, n = 3 per group. * p < 0.05 compared with the control group, # p < 0.05 compared with the CM group.

Article Snippet: Scutellarin (#THT033, Ronghe Medical Technology, Shanghai, China), F12/DMEM 1:1 high sugar medium (#C3130-0500, BI, Shanghai, China ), sugar-free culture medium (#C3122-500, BI, Shanghai, China), cell culture level anhydrous glucose (#G8150, Solarbio, Beijing, China), TUNEL kit (#PF00006, Proteintech, Wuhan, China), CCK-8 cell viability assay kit (#PF00004, Proteintech, Wuhan, China), rabbit cleaved caspase-3 antibody (#9664, Cell Signaling Technology, Massachusetts, USA), rabbit anti-caspase-3 antibody (#66470-2-Ig, Proteintech, Wuhan, China), rabbit anti-Bax antibody (#WL01637, Wanle, Shenyang, China), rabbit anti-B-cell lymphoma-2 (Bcl-2) antibody (#WL01556, Wanlei, Shenyang, China), rabbit anti-JAK2 antibody (#3230S, Cell Signaling Technology, Massachusetts, USA), rabbit anti-p-JAK2 antibody (#ab32101, Abcam, Cambridge, UK), rabbit anti-STAT3 antibody (#12640, Cell Signaling Technology, Massachusetts, USA), Rabbit p-STAT3 antibody (#9145S, Cell Signaling Technology, Massachusetts, USA), murine anti-β-actin antibody (#66009-1-Ig, Proteintech, Wuhan, China), murine anti-NeuN antibody (#66,836–1-Ig, Proteintech, Wuhan, China), horseradish peroxidase (HPR)-labelled anti-rabbit IgG antibody (#SA00001-2, Proteintech, Wuhan, China), HPR-labelled anti-mouse IgG antibody (#SA00001-1, Proteintech, Wuhan, China), DAPI-containing fluorescent coated tablets (#S2110, Solarbio, Beijing, China), Cy3-labelled goat anti-rabbit IgG antibody (#SA00009-2, Proteintech, Wuhan, China), AF488-labelled goat anti-mouse IgG antibody (#SA00013-1, Proteintech, Wuhan, China).

Techniques: Expressing, Western Blot, Staining, Fluorescence

Journal: Scientific Reports

Article Title: Effect of scutellarin on BV-2 microglial-mediated apoptosis in PC12 cells via JAK2/STAT3 signalling pathway

doi: 10.1038/s41598-024-64226-x

Figure Lengend Snippet: Effect of AG490 on the expression of JAK2/STAT3 signalling pathway-related proteins in PC12 cells. ( A ) Bands of western blotting. ( B ) Bar chart showing protein expression levels. ( C ) Images of immunofluorescent staining. Scale bar: 50 µm. ( D ) Bars of fluorescence intensity quantification. Data are shown as means ± standard deviation, n = 3 per group. ** p < 0.01, *** p < 0.001, **** p < 0.001 compared with the control group; ##p < 0.01, ###p < 0.001 compared with the CM group; NS p > 0.05 compared with the CM group; ▲p < 0.05, ▲▲p < 0.05 compared with the CM + S group.

Article Snippet: Scutellarin (#THT033, Ronghe Medical Technology, Shanghai, China), F12/DMEM 1:1 high sugar medium (#C3130-0500, BI, Shanghai, China ), sugar-free culture medium (#C3122-500, BI, Shanghai, China), cell culture level anhydrous glucose (#G8150, Solarbio, Beijing, China), TUNEL kit (#PF00006, Proteintech, Wuhan, China), CCK-8 cell viability assay kit (#PF00004, Proteintech, Wuhan, China), rabbit cleaved caspase-3 antibody (#9664, Cell Signaling Technology, Massachusetts, USA), rabbit anti-caspase-3 antibody (#66470-2-Ig, Proteintech, Wuhan, China), rabbit anti-Bax antibody (#WL01637, Wanle, Shenyang, China), rabbit anti-B-cell lymphoma-2 (Bcl-2) antibody (#WL01556, Wanlei, Shenyang, China), rabbit anti-JAK2 antibody (#3230S, Cell Signaling Technology, Massachusetts, USA), rabbit anti-p-JAK2 antibody (#ab32101, Abcam, Cambridge, UK), rabbit anti-STAT3 antibody (#12640, Cell Signaling Technology, Massachusetts, USA), Rabbit p-STAT3 antibody (#9145S, Cell Signaling Technology, Massachusetts, USA), murine anti-β-actin antibody (#66009-1-Ig, Proteintech, Wuhan, China), murine anti-NeuN antibody (#66,836–1-Ig, Proteintech, Wuhan, China), horseradish peroxidase (HPR)-labelled anti-rabbit IgG antibody (#SA00001-2, Proteintech, Wuhan, China), HPR-labelled anti-mouse IgG antibody (#SA00001-1, Proteintech, Wuhan, China), DAPI-containing fluorescent coated tablets (#S2110, Solarbio, Beijing, China), Cy3-labelled goat anti-rabbit IgG antibody (#SA00009-2, Proteintech, Wuhan, China), AF488-labelled goat anti-mouse IgG antibody (#SA00013-1, Proteintech, Wuhan, China).

Techniques: Expressing, Western Blot, Staining, Fluorescence, Standard Deviation